Journal: bioRxiv

Article Title: Targeted protein degradation in lysosome utilizing naturally produced bifunctional antibodies with high levels of mannose 6-phosphate glycans

doi: 10.1101/2024.09.03.611037

Figure Lengend Snippet: A . Schematic showing the procedure for detection of FLAG-mCherry and NCA-FLAG or PNCA-FLAG complexes binding toward CI-MPR. B . Bound mCherry fluorescence from (A) for NCA-FLAG (gray) or PNCA-FLAG (red). N=3 or 4. C . HepG2 cells were incubated with FLAG-mCherry and NCA-FLAG or PNCA-FLAG overnight with or without 2 mM M6P and cells were examined by fluorescent microscopy to detect mCherry signal (red). Lysosomes were stained with LysoTracker (green) and Hoechst (blue) for nuclei. D-H . Cell lines (D. HEK293T, E. Tay-Sachs Patient Fibroblasts, F. Daoy, G. HepG2, or H. MDA-MB-231) were incubated with FLAG-HexM enzyme with NCA-FLAG or PNCA-FLAG or with addition of 2 mM M6P. HexM internalization was determined by performing a HexM activity assay and activity graphed – HexM alone (gray), NCA-FLAG with HexM (Green), PNCA-FLAG with HexM (Blue), M6P added (black striped bars). Background HexM activity in untreated group wa subtracted. Dot represents each independent experiment. N=3-6. I . HEK293T CI-MPR -/- cells were generated by CRISPR-Cas9. Western blot shows CI-MPR deficiency in the cells. J . Graphs depict internalized HexM activity in CI-MPR -/- cells. Dot represents each independent experiment. N=3. Data are represented as mean values; error bars represent the standard deviation of biological replicates.

Article Snippet: HepG2 (ATCC, HB-8065), Daoy (ATCC, HTB-186) and A431 (Sigma, 85090402) cells were cultured in MEM medium (Corning, 10-009-CV) with 10% FBS.

Techniques: Binding Assay, Fluorescence, Incubation, Microscopy, Staining, Activity Assay, Generated, CRISPR, Western Blot, Standard Deviation

Journal: bioRxiv

Article Title: Targeted protein degradation in lysosome utilizing naturally produced bifunctional antibodies with high levels of mannose 6-phosphate glycans

doi: 10.1101/2024.09.03.611037

Figure Lengend Snippet: A . Schematic demonstrating production of Ab-TNFα and PNCA-TNFα in CHO cells. B . Western blotting to examine the Ab-TNFα and PNCA-TNFα heavy chain N-glycosylation after Endo-H and PNGase-F treatment. C-D . CI-MPR affinity chromatograph to determine the binding of Ab-TNFα and PNCA-TNFα. To visualize the binding signal, Alexa Fluor 594 conjugated to Ab-TNFα (C) or PNCA-TNFα (D) was used for the assay. Red dash line indicates the concentration of free M6P for antibody elution from the CI-MPR column. E . Schematic depicting internalization and degradation of extracellular TNFα b PNCA-TNFα through CI-MPR to the lysosome. F . HepG2 cells were incubated with mCherry-TNFα and Ab-TNFα or PNCA-TNFα overnight with or without 2 mM M6P and cells were examined by fluorescent microscopy to detect mCherry-TNFα signal (red). Lysosomes were stained with LysoTracker (green) and Hoechst for Nuclei (blue). G . Internalized mCherry-TNFα protein was analyzed by western blot for cell lysates using antibodies to detect mCherry, TNFα, and GAPDH as a loading control. H . Western blot analysis for internalized mCherry-TNFα with the addition of 1% or 0.5% of lysosomal protease inhibitors (PI). Antibodies are used to detect mCherry, TNFα and GAPDH, as a loading control.

Article Snippet: HepG2 (ATCC, HB-8065), Daoy (ATCC, HTB-186) and A431 (Sigma, 85090402) cells were cultured in MEM medium (Corning, 10-009-CV) with 10% FBS.

Techniques: Western Blot, Glycoproteomics, Binding Assay, Concentration Assay, Incubation, Microscopy, Staining, Control

Journal: bioRxiv

Article Title: PHF19 drives PRC2 sub-nuclear compartmentalization to promote motility in TNBC cells

doi: 10.1101/2025.03.13.642950

Figure Lengend Snippet: ( A-B ) Representative confocal fluorescence microscopy images of endogenous EZH2 (A) or SUZ12 (B) immunostaining in MDA-MB-231 and BoM-1833 cells. Insets highlight exemplary nuclear bodies of EZH2 or SUZ12 accumulation (arrows) in the BoM-1833 cells. Scale bar: 10 µm. Images were acquired and are displayed with identical settings. ( C ) Violin plot quantifying PRC2 body diameter in BoM-1833 cells. Each dot represents a single PRC2 body; data from 3 biological replicates (N = 16–32 cells). ( D ) Quantification of percentage of cell nuclei with PRC2 bodies in MDA-MB-231 and BoM-1833 cells, based on the images representatively shown in A-B. Data represent measurements from n = 3 biological replicates. Biological repeats are color coded. Statistical significance was determined via unpaired t-test, p=0.0102. Error bars indicate mean ±SEM. ( E ) Representative confocal fluorescence microscopy image of BoM-833 cells stained for endogenous PRC2 (SUZ12, green) and H3K27me3 (magenta) immunostaining in BoM-1833 cells. The arrow indicates an exemplary area of co-localization at a PRC2 body. Scale bar: 5 µm. ( F ) Schematic representation of the 3D photo-biotinylation approach used to map the proteome of endogenous PRC2 bodies. Total EZH2 (green) is spatially distributed within the cell and selectively photo-biotinylated at defined regions of interest (magenta) upon light activation. Following cell lysis, biotinylated proteins are captured using avidin-based immunoprecipitation and analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS). The figure was created using Biorender. ( G ) Volcano plot illustrating the proteomic content of PRC2 bodies in BoM-1833 cells. Analysis was performed on the 1384 proteins identified as enriched in the labeled versus control condition in all 4 biological repeats, with unique peptides ≥ 2, fold change ≥ 1.5; and t-test significance ≤ 0.05. The x-axis represents the log 2 enrichment ratio (2P/CTL), and the y-axis represents the -log 10 p-value, indicating statistical significance. The dotted horizontal line corresponds to the p-value threshold (p < 0.05). Members of the core PRC2 complex are labeled in green. ( H ) Representative confocal fluorescence microscopy images of endogenous PHF19 immunostaining in MDA-MB-231 and BoM-1833 cells. The arrow highlights exemplary accumulations of PHF19 within nuclear bodies in BoM-1833 cells. Scale bar: 20 µm. The images were acquired and are displayed with identical settings. ( I ) Violin plot showing the quantification of endogenous PHF19 body diameter in BoM-1833 cells based on the images representatively shown in (H). Data represent measurements from N = 14–17 cells across n = 3 biological replicates, with each dot representing the diameter of a single PHF19 body. Biological repeats are color coded. ( J ) Quantification of percentage of cell nuclei with PHF19 bodies in MDA-MB-231 and BoM-1833 cells, based on the images representatively shown in (I). Data represent measurements from n = 3 biological replicates. Biological repeats are color coded. Statistical significance was determined via unpaired t-test, p=0.003. Error bars indicate mean ±SEM. ( K ) Representative confocal fluorescence microscopy image of endogenous PHF19 (green) and H3K27me3 (magenta) immunostaining in BoM-1833 cells. The arrow indicates an exemplary area of co-localization at a PHF19 body. Scale bar: 5 µm. ( L ) Representative confocal fluorescence microscopy images of BoM-1833 cells, 24 h post transfection with a GFP-PHF19 (green) expression plasmid and immunostained for endogenous core PRC2 subunits (SUZ12, purple). The arrow indicates an exemplary area of co-localization. Scale bar: 10 µm.

Article Snippet: The cells were then incubated with the rabbit anti-EZH2 antibody (5246, Cell signaling, USA) for 4 hours at RT, washed 3 times with PBST for 5 min and then incubated with Alexa Fluor™ 647 secondary antibody (A-21245, ThermoFisher, USA) for 2 hours.

Techniques: Fluorescence, Microscopy, Immunostaining, Staining, Activation Assay, Lysis, Avidin-Biotin Assay, Immunoprecipitation, Liquid Chromatography, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy, Labeling, Control, Transfection, Expressing, Plasmid Preparation

Journal: bioRxiv

Article Title: PHF19 drives PRC2 sub-nuclear compartmentalization to promote motility in TNBC cells

doi: 10.1101/2025.03.13.642950

Figure Lengend Snippet: ( A-B ) Representative confocal fluorescence microscopy images of BoM-1833 cells transfected with the indicated siRNAs. Cells were fixed 96 hours post-transfection and immunostained for endogenous EZH2 (A) or SUZ12 (B). Regions of interest (ROIs) are highlighted, with inset images showing magnified views of the immunostained cells. Scale bar: 10 µm. Images that are to be directly compared where imaged and are displayed with identical settings. ( C ) Quantification of the percentage of nuclei exhibiting PRC2 bodies in BoM-1833 cells treated as in (A-B) and immunostained for PRC2 core subunits. Data represent measurements from N = 50–60 cells across n = 3 biological replicates. Biological repeats are color coded. Statistical significance was determined via one-way ANOVA testing, *** = 0.0003, ns= not significant. Error bars indicate mean ±SD. ( D ) BoM-1833 cells were transfected with the indicated siRNAs and lysed 96 hours later for Western blot analysis using the specified antibodies. GAPDH was used as loading control. ( E-I ) Densitometric analysis of PHF19 (E), EZH2 (F), SUZ12 (G), PHF1 (H) and MTF2 (I) protein levels in cell lysates obtained from BoM-1833 cells treated as described in (D). GAPDH was used for relative normalization of the chemiluminescence signal obtained for the different PRC2 subunits. Data represent measurements from n = 3 biological replicates, whereby the values for siPHF19 are reported relative to the mean value of the control (siNT) within each biological replicate. Biological repeats are color coded. Statistical significance was determined via one-way ANOVA testing, **** < 0.0001, ns = not significant. Error bars indicate mean ±SD.

Article Snippet: The cells were then incubated with the rabbit anti-EZH2 antibody (5246, Cell signaling, USA) for 4 hours at RT, washed 3 times with PBST for 5 min and then incubated with Alexa Fluor™ 647 secondary antibody (A-21245, ThermoFisher, USA) for 2 hours.

Techniques: Fluorescence, Microscopy, Transfection, Western Blot, Control

Journal: bioRxiv

Article Title: PHF19 drives PRC2 sub-nuclear compartmentalization to promote motility in TNBC cells

doi: 10.1101/2025.03.13.642950

Figure Lengend Snippet: ( A ) PHF19 gene expression analysis across a TCGA BRCA cohort sorted by molecular subtype subtype. Box plots display the expression levels of PHF19 in normal (grey) and tumor (green) tissue for the indicated breast cancer subtypes. Data are derived from TCGA/GTEx datasets and visualized using GEPIA2. Statistical significance between tumor and normal samples was determined by unpaired t-test (*p < 0.05). n= 291 (Normal), 194 (Luminal B), 415 (Luminal A), 66 (HER2), 135 (Basal-like). ( B-C ) Representative confocal microscopy images of EZH2 (B) and SUZ12 (C) immunostaining in the indicated cell lines. Scale bar: 20 µm. Images that are to be directly compared were recorded and are displayed using identical settings. ( D ) Quantification of the percentage of cell nuclei with PRC2 bodies in the indicated cell lines based on confocal microscopy images as shown in (B-C). Data represent measurements from N = 35– 55 cells across n = 3 biological replicates. Biological repeats are color coded. ( E ) Representative immunoblot analysis of full cell lysates prepared from the indicated cell lines and using the annotated antibodies. GAPDH was used as the loading control. ( F-G ) Densitometric quantification of EZH2, SUZ12 (F) and PCL family (G) subunit protein expression in the TNBC cell line panel used in this work. GAPDH was used for normalization of the chemiluminescence signal of the PRC2 subunits across cell lines. The data for siPHF19 are reported relative to the mean values for the siNT control. Data represent measurements from n = 3 biological replicates, error bars are mean ±SD. Measurements stemming from cell lines forming detectable PRC2 bodies by Airyscan microscopy were highlighted in red. ( H-I ) Representative confocal fluorescence microscopy images showing co-immunostaining of H3K27me3 with the endogenous PRC2 core subunit SUZ12 (H) and PHF19 (I) in MDA-MB-436 cells. Arrows indicate exemplary regions of colocalization. Scale bar: 10 µm (H), 5 µm (I). ( J ) Violin plot showing the quantification of PRC2 core and PHF19 protein body diameter as based on the images representatively shown in (F-G). Data represent measurements from N = 14–29 (core PRC2 subunits) and N= 19-22 (PHF19) cells across n = 3 biological replicates, with each dot representing the diameter of a single protein body. Biological repeats are color coded. ( K ) Representative confocal fluorescence microscopy images of MDA-MB-436 cells, 24 h post transfection with GFP-PHF19 (green) and immunostained for endogenous SUZ12 (purple). The arrow indicates an exemplary area of co-localization. Scale bar: 5 µm. ( L-M ) MDA-MB-436 cells were transfected with the indicated siRNAs followed by fixation 96 h later and immunostaining for endogenous EZH2 (L) or SUZ12 (M). The bottom row shows magnified views of the cropped fields of view. Images that are to be directly compared were acquired and are displayed using identical settings. Scale bar: 10 µm ( N ) Quantification of percentage of cell nuclei with PRC2 bodies in MDA-MB-436 cells transfected with the indicated siRNAs and imaged as representatively shown in (L-M). Data represent measurements from n = 3 biological replicates. Biological repeats are color coded. Statistical significance was determined via one-way ANOVA, ****= 0.001, ns= not significant. Error bars indicate mean ±SD. ( O ) MDA-MB-436 were treated as described in (L-M), followed by cell lysis. The material was analyzed by Western blot using the indicated antibodies. See also Figure S4. ( P , S ) Representative confocal microscopy images and ( R , T ) quantification of HS578T (P, R) and BT549 (S, T) fixed 24 h after transfection with a plasmid encoding for GFP-PHF19 (magenta) and immunostained for endogenous SUZ12 (PRC2 core). ROIs (Regions of Interest) are highlighted and magnified, showing the endogenous localization of SUZ12 in cells transfected with GFP-PHF19 (ROI 1) versus un-transfected cells (ROI 2). Scale bar: 20 µm. The bar diagrams show the endogenous SUZ12 localization phenotype in relation to the GFP-PHF19 expression status. Data represent measurements from N = 7–30 cells from n = 3 biological replicates. Biological repeats are color coded. Statistical significance was determined via unpaired t-test, * = 0.0123, **= 0.0038. Error bars indicate mean ±SD.

Article Snippet: The cells were then incubated with the rabbit anti-EZH2 antibody (5246, Cell signaling, USA) for 4 hours at RT, washed 3 times with PBST for 5 min and then incubated with Alexa Fluor™ 647 secondary antibody (A-21245, ThermoFisher, USA) for 2 hours.

Techniques: Gene Expression, Expressing, Derivative Assay, Confocal Microscopy, Immunostaining, Western Blot, Control, Microscopy, Fluorescence, Transfection, Lysis, Plasmid Preparation

Journal: The Journal of biological chemistry

Article Title: A minimally lipidated form of cell-derived apolipoprotein E exhibits isoform-specific stimulation of neurite outgrowth in the absence of exogenous lipids or lipoproteins.

doi: 10.1074/jbc.273.7.4206

Figure Lengend Snippet: FIG. 2. Western blotting of apoE secreted by stably transfected cell lines. Conditioned media (100 mg of protein) were separated by SDS-10% polyacrylamide gel electrophoresis and were electroblotted to a nitrocellulose membrane. The membrane was probed with an affinity purified polyclonal goat anti-human apoE antibody. After incubation with a horseradish peroxidase-conjugated anti-goat IgG, bands were visualized by enhanced chemiluminescence. The slight difference in mobility of the apoE3 and apoE4 bands is due to curvature in the running front and was not seen in other experiments.

Article Snippet: The cells were washed three times with PBS containing 0.5% Triton X-100 and incubated with a rhodamine-conjugated donkey anti-goat IgG antibody (Jackson Immuno Research) at 1:2000 in in PBS containing 1% FBS and 0.5% Triton X-100 for 1 h at 37 °C.

Techniques: Western Blot, Stable Transfection, Transfection, Polyacrylamide Gel Electrophoresis, Membrane, Affinity Purification, Incubation

Journal: The Journal of biological chemistry

Article Title: A minimally lipidated form of cell-derived apolipoprotein E exhibits isoform-specific stimulation of neurite outgrowth in the absence of exogenous lipids or lipoproteins.

doi: 10.1074/jbc.273.7.4206

Figure Lengend Snippet: FIG. 3. Immunocytochemical detection of apoE in stably transfected cell lines. Neuro-2a parental cells (A and B), Neuro-2a apoE3- secreting cells (C), and Neuro-2a apoE4-secreting cells (D) were grown on glass coverslips. ApoE localization was detected with an affinity purified polyclonal goat anti-human apoE antibody and a rhodamine-conjugated secondary antibody (A, C, and D). The white arrows highlight the concentrated localization of apoE in the growth cone domains in the apoE isoform-expressing Neuro-2a cells. B is the transmitted light image of the parental Neuro-2a cells found in A (black arrows highlight 2 Neuro-2a cells). All images were collected by confocal microscopy with a 40 3 oil immersion lens.

Article Snippet: The cells were washed three times with PBS containing 0.5% Triton X-100 and incubated with a rhodamine-conjugated donkey anti-goat IgG antibody (Jackson Immuno Research) at 1:2000 in in PBS containing 1% FBS and 0.5% Triton X-100 for 1 h at 37 °C.

Techniques: Stable Transfection, Transfection, Affinity Purification, Expressing, Confocal Microscopy

Journal: The Journal of biological chemistry

Article Title: Requirement of p38 mitogen-activated protein kinase for neuronal differentiation in PC12 cells.

doi: 10.1074/jbc.273.38.24285

Figure Lengend Snippet: FIG. 2. Inhibition of p38 blocks NGF-induced neurite out- growth. A and B, PC12 cells were pretreated with the indicated con- centrations of SB203580 or 30 mM PD98059 for 30 min prior to treat- ment with 100 ng/ml NGF for 60 h. Representative images under a phase-contrast microscope (A) and quantitation of the percentage of cells with neurites (B) are shown. C and D, cells were cotransfected with pEGFP-C1 together with an empty expression vector SRa (2) or an expression vector encoding kinase-negative MKK6 (KN-MKK6), wild type p38 (WT-p38), or dominant-negative p38 (AGF-p38) (15). After 12 h the cells were treated with or without 10 mM SB203580. Then, 48 h after the transfection the cells were treated with or without 100 ng/ml NGF. Representative images of the transfected cells 60 h after NGF addition identified by the fluorescence of GFP (C) and quantitation of the percentage of cells with neurites (D) are shown.

Article Snippet: Anti-p38 antiserum was produced by immunizing rabbits with recombinant His-tagged p38.3 Anti-HA antibody and anti-p38 antibody were purchased from Santa Cruz Biotechnology.

Techniques: Inhibition, Microscopy, Quantitation Assay, Expressing, Plasmid Preparation, Dominant Negative Mutation, Transfection, Fluorescence

Journal: The Journal of biological chemistry

Article Title: Requirement of p38 mitogen-activated protein kinase for neuronal differentiation in PC12 cells.

doi: 10.1074/jbc.273.38.24285

Figure Lengend Snippet: FIG. 1. NGF induces p38 activation as well as ERK/MAPK ac- tivation. A, PC12 cells were treated with 100 ng/ml NGF or 50 mM arsenite for the indicated times (left) or with the indicated concentra- tions of NGF for 10 min (right), and the cell extracts were subjected to the immune complex kinase assay for p38 using activating transcrip- tion factor 2, ATF2, as a substrate (upper). The same cell extracts were subjected to immunoblotting with anti-phospho-p38 (middle) or anti- p38 antibodies (bottom). B, cells were pretreated with or without a p38 inhibitor SB203580 at 10 mM (lower or upper, respectively) for 30 min prior to NGF treatment as indicated, and the extracts were subjected to immunoblotting with anti-ERK/MAPK antibody. The electrophoreti- cally retarded bands represent active forms, i.e. phosphorylated forms of ERK/MAPK (ERK1 and ERK2, arrowheads) against inactive forms (arrows).

Article Snippet: Anti-p38 antiserum was produced by immunizing rabbits with recombinant His-tagged p38.3 Anti-HA antibody and anti-p38 antibody were purchased from Santa Cruz Biotechnology.

Techniques: Activation Assay, Immune Complex Kinase Assay, Western Blot

Journal: The Journal of biological chemistry

Article Title: Requirement of p38 mitogen-activated protein kinase for neuronal differentiation in PC12 cells.

doi: 10.1074/jbc.273.38.24285

Figure Lengend Snippet: FIG. 3. Expression of a constitutively active MAPKK/MEK (SE- SE-KK) induces p38 activation as well as ERK/MAPK, and the p38 inhibitor blocks neurite outgrowth induced by SESE-KK. A, PC12 cells were cotransfected with pEGFP-C1 and either an empty expression vector SRa (2) or a constitutively active construct of MAPKK/MEK (SESE-KK (13); equivalent to Glu-217/Glu-221 MAPKK/ MEK in Ref. 7) expression vector and were treated with or without 10 mM SB203580. B, cells were cotransfected with HA-p38 or HA-ERK/ MAPK (MAPK) together with an empty expression vector SRa (2) or an expression vector encoding wild type MAPKK/MEK (WT-KK) or SE- SE-KK and assayed for the activity of HA-p38 or HA-MAPK. The activity of HA-p38 was also measured in cells treated with 100 ng/ml NGF for 10 min (1NGF). C, cells were cotransfected with pEGFP-C1 and either an empty expression vector SRa (2) or an SESE-KK expres- sion vector and were subjected to immunostaining with anti-phospho- p38 antibody.

Article Snippet: Anti-p38 antiserum was produced by immunizing rabbits with recombinant His-tagged p38.3 Anti-HA antibody and anti-p38 antibody were purchased from Santa Cruz Biotechnology.

Techniques: Expressing, Activation Assay, Plasmid Preparation, Construct, Activity Assay, Immunostaining

Journal: The Journal of biological chemistry

Article Title: Requirement of p38 mitogen-activated protein kinase for neuronal differentiation in PC12 cells.

doi: 10.1074/jbc.273.38.24285

Figure Lengend Snippet: FIG. 4. EGF induces transient activation of p38 and, when combined with sustained activation of p38, causes neurite out- growth in PC12 cells. A, PC12 cells were treated with either 30 nM EGF (upper), 50 mM arsenite (upper), or 100 ng/ml NGF (lower) for the indicated times and assayed for p38 activity as described in the legend to Fig. 1A. B, cells were treated with EGF, NGF, or arsenite for the indicated times and subjected to immunostaining with anti-phospho- p38 antibody (lower; phase contrast, upper). C, cells were transfected with pEGFP-C1 together with either an empty expression vector SRa (2) or both wild type MKK6 and wild type p38 expression vectors (MKK6 & p38) and treated with or without 10 mM SB203580. 48 h after the transfection the cells were treated with or without EGF. Represent- ative images of the transfected cells 72 h after EGF addition identified by the fluorescence of GFP are shown. D, cells were treated with EGF, arsenite, or both for 1 h, washed, and then incubated in fresh medium. Representative images 60 h after the treatment under a phase-contrast microscope are shown.

Article Snippet: Anti-p38 antiserum was produced by immunizing rabbits with recombinant His-tagged p38.3 Anti-HA antibody and anti-p38 antibody were purchased from Santa Cruz Biotechnology.

Techniques: Activation Assay, Activity Assay, Immunostaining, Transfection, Expressing, Plasmid Preparation, Fluorescence, Incubation, Microscopy

Journal: The Journal of biological chemistry

Article Title: A bipartite nuclear localization signal is required for p53 nuclear import regulated by a carboxyl-terminal domain.

doi: 10.1074/jbc.274.46.32699

Figure Lengend Snippet: FIG. 1. Effect of LMB on the subcellular localization of Lys305- mutated p53. MCF-7 cells grown on coverslips were transfected with p53K305-GFP and treated with or without 100 nM LMB for 4 h. The cellular localization of cyclin B1 in transfected cells was determined by immunostaining with a monoclonal anti-cyclin B1 antibody and an LRSC-conjugated goat anti-mouse IgG. The localizations of Lys305-mu- tated p53 and cyclin B1 were differentiated by GFP and LRSC fluores- cence using fluorescence microscopy.

Article Snippet: After washing, one-twentieth of the beads were removed to analyze the amount of immobilized GST fusion proteins by immunoblotting with the anti-p53 pAb122 hybridoma supernatant (ATCC TIB116) or the anti-GST mouse IgG1 monoclonal antibody (Santa Cruz Biotechnology).

Techniques: Transfection, Immunostaining, Fluorescence, Microscopy

Journal: The Journal of biological chemistry

Article Title: A bipartite nuclear localization signal is required for p53 nuclear import regulated by a carboxyl-terminal domain.

doi: 10.1074/jbc.274.46.32699

Figure Lengend Snippet: FIG. 2. Subcellular localizations of p53 nuclear localization signals and PK fusion derivatives. The p53 residues 316–322 (NLSI), 305–322, or K305N-322 were linked to the KpnI sites in the carboxyl terminus of a Myc-tagged PK cDNA. The different fusion constructs were transiently transfected into MCF-7 cells, and the cel- lular localization of fusion proteins was determined by immunostaining with a monoclonal anti-c-Myc antibody and a fluorescein isothiocya- nate-conjugated goat anti-mouse IgG.

Article Snippet: After washing, one-twentieth of the beads were removed to analyze the amount of immobilized GST fusion proteins by immunoblotting with the anti-p53 pAb122 hybridoma supernatant (ATCC TIB116) or the anti-GST mouse IgG1 monoclonal antibody (Santa Cruz Biotechnology).

Techniques: Construct, Transfection, Immunostaining

Journal: The Journal of biological chemistry

Article Title: A bipartite nuclear localization signal is required for p53 nuclear import regulated by a carboxyl-terminal domain.

doi: 10.1074/jbc.274.46.32699

Figure Lengend Snippet: FIG. 5. Co-localization of the p53 oligomerization domain with wild-type and Lys305-mutated p53. A FLAG fusion protein contain- ing the p53 oligomerization domain (residues 325–369) was expressed alone or co-expressed with p53-GFP or p53K305N-GFP in MCF-7 cells. The cellular localization of FLAG-p53-(325–369) was determined by immunostaining with a monoclonal anti-FLAG antibody and an LRSC- conjugated goat anti-mouse IgG.

Article Snippet: After washing, one-twentieth of the beads were removed to analyze the amount of immobilized GST fusion proteins by immunoblotting with the anti-p53 pAb122 hybridoma supernatant (ATCC TIB116) or the anti-GST mouse IgG1 monoclonal antibody (Santa Cruz Biotechnology).

Techniques: Immunostaining

Journal: International journal of molecular sciences

Article Title: Regulation of the Golgi Apparatus by p38 and JNK Kinases during Cellular Stress Responses.

doi: 10.3390/ijms22179595

Figure Lengend Snippet: Figure 1. Phospho-proteomic analysis of p38- and JNK-dependent phosphorylation reactions. (a). Schematic of phospho- proteomic workflow. U2OS cells were treated in duplicates with indicated combinations of anisomycin (Ani, 1 h) and p38 and JNK inhibitors (p38i, JNKi, 0.5 h pre-treatment). Lysates were digested with trypsin and peptides were labeled with

Article Snippet: Membranes were blocked in PBS-T + 5% milk and then probed with the following antibodies overnight: Phospho RxxS*/T* (Cell signaling, 9614, rabbit), GIGYF1 (Abcam, ab121784 and ab121646, rabbit), MK2 (Cell signaling, 3042, rabbit), CHK1 (S345, Cell signaling, 2358, rabbit), 14–3–3 (pan, Cell signaling, 8312, rabbit), GST (Santa Cruz, discontinued, sc459, rabbit), TTP (Sigma, T5327, rabbit), ZNF598 (Abcam, ab111698, rabbit and/or Sigma, HPA041760, rabbit), FLAG (Sigma, F1804, rabbit and/or Sigma, F1804, mouse) or 4EHP (Cell signaling, 6916, rabbit), GRASP55 (Abcam, Ab211532, mouse), CAMSAP2 (Novus, Abingdon, UK, NCP1–21402, rabbit), TJAP1 (Sigma, HPA030165, rabbit), GM130 (BD biosciences, Franklin Lakes, NJ, USA Clone 35, mouse), YIPF2 (Santa Cruz, sc-398530, mouse), p-JNK (Cell signaling, 9255, mouse), p-p38 (T180/Y182, Cell signaling, 9216, mouse), p150 (BD biosciences, 610473, mouse), MCM6 (Santa Cruz, goat), HA (Santa Cruz, sc-7392, mouse) and GFP (Torrey Pines, Secaucus, NJ, USA TP401, rabbit).

Techniques: Phospho-proteomics, Labeling

Journal: International journal of molecular sciences

Article Title: Regulation of the Golgi Apparatus by p38 and JNK Kinases during Cellular Stress Responses.

doi: 10.3390/ijms22179595

Figure Lengend Snippet: Figure 3. GIGYF1 phospho-mutant retains p-body localization upon cellular stress. (a). U2OS cells were transfected with the indicated siRNA, pre-treated with p38 and MK2 inhibitors (0.5 h) and UV-irradiated (50 J/m2, 1 h recovery) as indicated. Lysates were incubated with recombinant GST-14–3–3 protein or GST alone. GST pull-down material (PD: GST) and whole

Article Snippet: Membranes were blocked in PBS-T + 5% milk and then probed with the following antibodies overnight: Phospho RxxS*/T* (Cell signaling, 9614, rabbit), GIGYF1 (Abcam, ab121784 and ab121646, rabbit), MK2 (Cell signaling, 3042, rabbit), CHK1 (S345, Cell signaling, 2358, rabbit), 14–3–3 (pan, Cell signaling, 8312, rabbit), GST (Santa Cruz, discontinued, sc459, rabbit), TTP (Sigma, T5327, rabbit), ZNF598 (Abcam, ab111698, rabbit and/or Sigma, HPA041760, rabbit), FLAG (Sigma, F1804, rabbit and/or Sigma, F1804, mouse) or 4EHP (Cell signaling, 6916, rabbit), GRASP55 (Abcam, Ab211532, mouse), CAMSAP2 (Novus, Abingdon, UK, NCP1–21402, rabbit), TJAP1 (Sigma, HPA030165, rabbit), GM130 (BD biosciences, Franklin Lakes, NJ, USA Clone 35, mouse), YIPF2 (Santa Cruz, sc-398530, mouse), p-JNK (Cell signaling, 9255, mouse), p-p38 (T180/Y182, Cell signaling, 9216, mouse), p150 (BD biosciences, 610473, mouse), MCM6 (Santa Cruz, goat), HA (Santa Cruz, sc-7392, mouse) and GFP (Torrey Pines, Secaucus, NJ, USA TP401, rabbit).

Techniques: Mutagenesis, Transfection, Irradiation, Incubation, Recombinant

Journal: International journal of molecular sciences

Article Title: Regulation of the Golgi Apparatus by p38 and JNK Kinases during Cellular Stress Responses.

doi: 10.3390/ijms22179595

Figure Lengend Snippet: Figure 4. JNK phosphorylation targets in the Golgi apparatus. (a). JNK- and p38-dependent phosphorylation sites on Golgi apparatus-resident proteins or Golgi trafficking proteins extracted from Figure 1c, Table S1 and [11]. (b). U2OS cells were pre-treated with JNK and p38 inhibitors (JNKi, p38i, 0.5 h) and treated with anisomycin (Ani, 1 h) as indicated. Lysates were separated by SDS-PAGE or phos-tag gel and analyzed by immunoblotting with the indicated antibodies.

Article Snippet: Membranes were blocked in PBS-T + 5% milk and then probed with the following antibodies overnight: Phospho RxxS*/T* (Cell signaling, 9614, rabbit), GIGYF1 (Abcam, ab121784 and ab121646, rabbit), MK2 (Cell signaling, 3042, rabbit), CHK1 (S345, Cell signaling, 2358, rabbit), 14–3–3 (pan, Cell signaling, 8312, rabbit), GST (Santa Cruz, discontinued, sc459, rabbit), TTP (Sigma, T5327, rabbit), ZNF598 (Abcam, ab111698, rabbit and/or Sigma, HPA041760, rabbit), FLAG (Sigma, F1804, rabbit and/or Sigma, F1804, mouse) or 4EHP (Cell signaling, 6916, rabbit), GRASP55 (Abcam, Ab211532, mouse), CAMSAP2 (Novus, Abingdon, UK, NCP1–21402, rabbit), TJAP1 (Sigma, HPA030165, rabbit), GM130 (BD biosciences, Franklin Lakes, NJ, USA Clone 35, mouse), YIPF2 (Santa Cruz, sc-398530, mouse), p-JNK (Cell signaling, 9255, mouse), p-p38 (T180/Y182, Cell signaling, 9216, mouse), p150 (BD biosciences, 610473, mouse), MCM6 (Santa Cruz, goat), HA (Santa Cruz, sc-7392, mouse) and GFP (Torrey Pines, Secaucus, NJ, USA TP401, rabbit).

Techniques: Phospho-proteomics, SDS Page, Western Blot

Journal: International journal of molecular sciences

Article Title: Regulation of the Golgi Apparatus by p38 and JNK Kinases during Cellular Stress Responses.

doi: 10.3390/ijms22179595

Figure Lengend Snippet: Figure 5. Regulation of Golgi morphology by p38 and JNK. (a). Heatmap and horizontal clustering of descriptors of Golgi morphology. U2OS cells were pre-treated with the combination of JNK and p38 inhibitors (JNKi, p38i, 0.5 h) and treated with anisomycin (Ani, 1 h) or IL1β (1 h) as indicated. Cells were fixed, immunostained with antibodies against cis Golgi markers GM130, GRASP65 and/or trans Golgi markers GRASP55 and TGN46 and images were acquired by high content microscopy. Images were processed and analyzed with CellProfiler software for calculation of the indicated parameters, and are presented as log2-transformed mean fold changes compared to the control. n > 1700 cells. (b). Box plots of selected

Article Snippet: Membranes were blocked in PBS-T + 5% milk and then probed with the following antibodies overnight: Phospho RxxS*/T* (Cell signaling, 9614, rabbit), GIGYF1 (Abcam, ab121784 and ab121646, rabbit), MK2 (Cell signaling, 3042, rabbit), CHK1 (S345, Cell signaling, 2358, rabbit), 14–3–3 (pan, Cell signaling, 8312, rabbit), GST (Santa Cruz, discontinued, sc459, rabbit), TTP (Sigma, T5327, rabbit), ZNF598 (Abcam, ab111698, rabbit and/or Sigma, HPA041760, rabbit), FLAG (Sigma, F1804, rabbit and/or Sigma, F1804, mouse) or 4EHP (Cell signaling, 6916, rabbit), GRASP55 (Abcam, Ab211532, mouse), CAMSAP2 (Novus, Abingdon, UK, NCP1–21402, rabbit), TJAP1 (Sigma, HPA030165, rabbit), GM130 (BD biosciences, Franklin Lakes, NJ, USA Clone 35, mouse), YIPF2 (Santa Cruz, sc-398530, mouse), p-JNK (Cell signaling, 9255, mouse), p-p38 (T180/Y182, Cell signaling, 9216, mouse), p150 (BD biosciences, 610473, mouse), MCM6 (Santa Cruz, goat), HA (Santa Cruz, sc-7392, mouse) and GFP (Torrey Pines, Secaucus, NJ, USA TP401, rabbit).

Techniques: Microscopy, Software, Transformation Assay, Control

Journal: Nature

Article Title: DAXX represents a new type of protein-folding enabler.

doi: 10.1038/s41586-021-03824-5

Figure Lengend Snippet: Fig. 1 | DAXX prevents protein misfolding and aggregation. a, b, Heat-induced luciferase inactivation (a, 5 nM) and aggregation (b, 200 nM) in presence or absence of GST, DAXX and HSP70–HSP40 at 200 nM (a) or at the indicated molar ratios (b). c, Aggregation of ATXN1(82Q) (50 nM) in the presence or absence of glutathione S-transferase (GST) or DAXX (200 nM each). Raw data for this and other gels are found in Supplementary Fig 1. PE, pelletable aggregates that were soluble with SDS; SN, supernatant. d–f, Fibrillization of α-Syn (70 μM) in the presence GST, HSP70–HSP40, HSPs (HSP70–HSP40–HSP104(A503S)) (200 nM each) and DAXX (100–400 nM) was assayed by ThT-binding (d), electron microscopy (e; red arrows, fibrils; blue arrows, large oligomers; scale bar, 100 nm), and sedimentation followed by dot blot for SDS-soluble and SDS-resistant (SR) aggregates and total α-Syn and by disuccinimidyl suberate (DSS) cross-linking for soluble oligomers (f). IB, immunoblot. g–i, Fibrillization of Aβ42 monomers (10 μM) in the absence or presence of DAXX (50–600 nM) (g, h), and viability of SH-SY5Y cells treated with Aβ42 pre-incubated with or without DAXX (i). An ATP-regeneration system was included with heat-shock proteins but not DAXX (all subsequent experiments with heat-shock proteins, but not experiments with DAXX, also contained an ATP-regeneration system). Data are mean or mean ± s.d. (n = 4 for i, and 3 for the rest) and are representative of three independent experiments. *P < 0.05, NS, not significant; unpaired Student’s t-test.

Article Snippet: Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology Animals and other organisms Human research participants Clinical data Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used Antibodies against the following proteins/epitopes were purchased from the indicated sources: GAPDH (sc-47724,Mouse, WB, IP, IF and IHC(P)), His (sc-8036, Mouse, IP, WB, IHC(P), ELISA, IF, FCM), GST (sc-138, Mouse, IP, WB, IHC(P), ELISA, IF, FCM), p53DO1 (sc-126, Mouse, WB, IP, IF, IHC(P) and FCM), Mdm2 (sc-965, Mouse, WB, IP, IF and IHC(P)), DAXX (sc-8043, Mouse IP,WB, IHC(P), ELISA, IF, FCM), α-synuclein syn211 (sc-12767, Mouse, IP, WB, IHC(P), ELISA, IF, and FCM) (Santa Cruz Biotechnology); Flag (#14793, Rabbit, WB, IP, IHC, ChIP, IF, FCM, ELISA) and DAXX (#4533S, Rabbit, WB, IP, IHC, ChIP, IF, FCM, ELISA) (Cell Signaling Technology); p53 (PAb1620, #OP33, Mouse, WB, IP, IF; PAb240, #OP29, Mouse, WB, IP), and Mdm2 (#OP46, Mouse, WB, IP) (Calbiochem); and HA (ab137838, Rabbit, WB, ICC/IF, IP) and Luciferase (ab21176, Rabbit, ICC/IF, WB) (Abcam); βAmyloid 1-42 (#805509) (BioLegend, Mouse, WB, IHC(P), ELISA).

Techniques: Luciferase, Binding Assay, Electron Microscopy, Sedimentation, Dot Blot, Western Blot, Incubation

Journal: Frontiers in pharmacology

Article Title: Curcumin Derivative Cur20 Attenuated Cerebral Ischemic Injury by Antioxidant Effect and HIF-1α/VEGF/TFEB-Activated Angiogenesis.

doi: 10.3389/fphar.2021.648107

Figure Lengend Snippet: FIGURE 6 | Expression of HIF-1 a (A), VEGF (B), TFEB (C), and CD34 (D) in cerebral cortex analyzed by immunohistochemistry. *p < 0.05 vs. sham group, **p < 0.01 vs. sham group; #p < 0.05 vs. Model group, ##p < 0.01 vs. Model group.

Article Snippet: Brain slices were incubated with antibodies (BosterBioengineering, Wuhan, China) against HIF-1α, CD34, NF-κB, VEGF, TFEB (rabbit polyclonal IgGantibody; 1:100) at 4°C and reacted with avidin-biotin-peroxidase complex and DAB (Boster Bio-engineering, Wuhan, China).

Techniques: Expressing, Immunohistochemistry

Journal: Frontiers in pharmacology

Article Title: Curcumin Derivative Cur20 Attenuated Cerebral Ischemic Injury by Antioxidant Effect and HIF-1α/VEGF/TFEB-Activated Angiogenesis.

doi: 10.3389/fphar.2021.648107

Figure Lengend Snippet: FIGURE 9 | Effect of Cur20 on the HIF-1α/VEGF/TFEB pathway. A–E, The protein levels of HIF-1α, NF-κB, VEGF, and TFEB analyzed by western blot. F, The content and translocation of TFEB in nuclei observed by confocal microscopy with immunofluorescence. rBMECs were pretreated with Cur20 for 2 h then treated with OGD for 4 h. L, M, or H represents the concentration of Cur20 as 0.1, 1, 10 μM, respectively. In the immunofluorescence experiment, the concentration of Cur20 was 10 μM. The experimental data was expressed by mean ± SD, n 3.*p < 0.05 vs. control group, #p < 0.05 vs. Model group.

Article Snippet: Brain slices were incubated with antibodies (BosterBioengineering, Wuhan, China) against HIF-1α, CD34, NF-κB, VEGF, TFEB (rabbit polyclonal IgGantibody; 1:100) at 4°C and reacted with avidin-biotin-peroxidase complex and DAB (Boster Bio-engineering, Wuhan, China).

Techniques: Western Blot, Translocation Assay, Confocal Microscopy, Concentration Assay, Control

Journal: Frontiers in oncology

Article Title: The Neurogenic Compound P7C3 Regulates the Aerobic Glycolysis by Targeting Phosphoglycerate Kinase 1 in Glioma.

doi: 10.3389/fonc.2021.644492

Figure Lengend Snippet: FIGURE 3 | P7C3 reduces the protein level of PGK1 and PGK2. (A) Representative spots of P7C3 target proteins, including the glycolytic process. (B) Western blotting for detecting protein levels of P7C3 target proteins that are related to glycolysis after U87MG and U118MG cells were treated with P7C3 at a concentration of 0 mM, 30 mM, and 50 mM for 24 h. (C) PGK1 activity levels in P7C3-treated U87MG and U118MG cells at a concentration of 0 mM, 30 mM, and 50 mM (n = 4). (D) The expression profiles of PGK1 and PGK2 mRNA levels. Data were obtained from the Human Protein Atlas database. The images are available at: https://www. proteinatlas.org/ENSG00000102144-PGK1/cell, and (https://www.proteinatlas.rg/ENSG00000170950-PGK2/cell). (E) Statistical analysis of PGK1 mRNA level among WHO grade II-IV glioma. The data were based on TCGA and CGGA and are available at: http://gliovis.bioinfo.cnio.es/. (F) Kaplan–Meier survival analysis of PGK1 mRNA level in glioma patients. The data were based on TCGA and CGGA and are available at: http://gliovis.bioinfo.cnio.es/. (The data were expressed as mean ± SD, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).

Article Snippet: Recombinant human PGK1 (GST-PGK1, ag12119, Proteintech, USA) was purchased from Proteinteck Group, Inc. Antibodies used in this study are as follows: HK1 (#2024, CST, USA), HK2 (#2867, CST, USA), GCK (#3782, CST, USA), ALDOA (#8060, CST, USA), PGK1(sc-130335, Santa Cruz, USA), PGK2 (ab183031, Abcam, USA), GST (#2624, CST, USA), GAPDH (#5174, CST, USA), Beclin-1 (#3495, CST, USA), LC3A/B (#12741, CST, USA), Iba1 (ab178846, Abcam, USA), SOX10 (ab227680, Abcam, USA), GFAP (ab68428, Abcam, USA), and b-Tubulin (#2128, CST, USA).

Techniques: Western Blot, Concentration Assay, Activity Assay, Expressing

Journal: Frontiers in oncology

Article Title: The Neurogenic Compound P7C3 Regulates the Aerobic Glycolysis by Targeting Phosphoglycerate Kinase 1 in Glioma.

doi: 10.3389/fonc.2021.644492

Figure Lengend Snippet: FIGURE 4 | P7C3 directly binds to PGK1. (A) Streptavidin affinity assay for P7C3-Bio binds to PGK1 in P7C3-treated glioma cells. Cells in culture were treated with 50 mM P7C3-Bio for 24 h, and then streptavidin agarose was added to incubate with the cell lysates. (B) Streptavidin affinity assay for P7C3-Bio binds to PGK1 upon cell lysates. Cell lysates were incubated with 10 mM P7C3-Bio at 37°C for 1 h, and then streptavidin agarose was added to incubate with the cell lysates. (C) Streptavidin affinity assay for P7C3-Bio binds to purified PGK1 protein. In total, 25 mg recombinant human PGK1 solution was incubated with 10 mM P7C3-Bio at 37°C for 1 h, and then streptavidin agarose was added to incubate with the cell lysates. (D) Motif analysis based on top 100 P7C3 target proteins was performed by MEME, and three motifs were identified. The motif consensus and motif locations at PGK1 are shown. (E) The P7C3 binding sites of PGK1 were identified by ESI-LC-MSMS. The P7C3 binding sites were identified by the predicted peptide mass plus P7C3 [C21H18Br2N2O with a loss of a water] and minus one H.

Article Snippet: Recombinant human PGK1 (GST-PGK1, ag12119, Proteintech, USA) was purchased from Proteinteck Group, Inc. Antibodies used in this study are as follows: HK1 (#2024, CST, USA), HK2 (#2867, CST, USA), GCK (#3782, CST, USA), ALDOA (#8060, CST, USA), PGK1(sc-130335, Santa Cruz, USA), PGK2 (ab183031, Abcam, USA), GST (#2624, CST, USA), GAPDH (#5174, CST, USA), Beclin-1 (#3495, CST, USA), LC3A/B (#12741, CST, USA), Iba1 (ab178846, Abcam, USA), SOX10 (ab227680, Abcam, USA), GFAP (ab68428, Abcam, USA), and b-Tubulin (#2128, CST, USA).

Techniques: Incubation, Recombinant, Binding Assay

Journal: Frontiers in oncology

Article Title: The Neurogenic Compound P7C3 Regulates the Aerobic Glycolysis by Targeting Phosphoglycerate Kinase 1 in Glioma.

doi: 10.3389/fonc.2021.644492

Figure Lengend Snippet: FIGURE 5 | P7C3 accelerates PGK1 protein degradation. (A) PGK1 mRNA level was measured by RT-PCR. P7C3 upregulates the PGK1 mRNA levels in U87MG and U118MG cells (n = 3). (B) Time-course assay of P7C3 effects on PGK1 degradation. U87MG and U118MG cells were treated by CHX (100 ug/mL) with or without P7C3 (50 mM) for 24 h, and then PGK1 protein levels were detected by western blotting. (C) Protein level curve for PGK1 based on time-course analysis of U87MG and U118MG cells (n = 3). (D) Western blotting of PGK1 protein degradation pathway. MG132 (5 mM) and CQ (20 mM) were used to treat cells for 6 h, followed by P7C3 treatment for another 18 h, and the protein level of PGK1 was detected by western blotting. (E) The statistical analysis of the quantized protein levels of PGK1 in U87MG and U118MG cells (n = 3). (F) Transmission electron microscopy assay after glioma cells were treated with P7C3 for 24 hours. Autophagosomes, autolysosomes, and phagophores are indicated by yellow, green, and red arrows (scale bar: original mage, 5 mm; Zoom image, 1 mm). (G) Western blotting for two key autophagy-associated proteins Beclin-1, and LC3A/B, after U87MG and U118MG cells were treated with 0 mM, 30 mM, and 50 mM P7C3 for 24 h. (Data are expressed as mean ± SD, nsP > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, ns means none significance).

Article Snippet: Recombinant human PGK1 (GST-PGK1, ag12119, Proteintech, USA) was purchased from Proteinteck Group, Inc. Antibodies used in this study are as follows: HK1 (#2024, CST, USA), HK2 (#2867, CST, USA), GCK (#3782, CST, USA), ALDOA (#8060, CST, USA), PGK1(sc-130335, Santa Cruz, USA), PGK2 (ab183031, Abcam, USA), GST (#2624, CST, USA), GAPDH (#5174, CST, USA), Beclin-1 (#3495, CST, USA), LC3A/B (#12741, CST, USA), Iba1 (ab178846, Abcam, USA), SOX10 (ab227680, Abcam, USA), GFAP (ab68428, Abcam, USA), and b-Tubulin (#2128, CST, USA).

Techniques: Reverse Transcription Polymerase Chain Reaction, Western Blot, Transmission Assay, Electron Microscopy

Journal: Frontiers in oncology

Article Title: The Neurogenic Compound P7C3 Regulates the Aerobic Glycolysis by Targeting Phosphoglycerate Kinase 1 in Glioma.

doi: 10.3389/fonc.2021.644492

Figure Lengend Snippet: FIGURE 7 | P7C3 inhibits glioma in vivo. (A) Representative in vivo IVIS Luc fluorescence images of xenografts mice on days 7 and 21 after injection of U87MG cells. (B) Statistical result of photon flux in xenografts mice on days 7 and 21 (n = 12). (C) Kaplan–Meier curves of survival rate of xenografts mice (n = 6). (D) Immunohistochemical staining of PGK1 in the indicated tumor tissues was performed, PGK1 positive cells were stained brown (scale bar: 20 mm). (E) Immunohistochemical staining of Ki67 in the indicated tumor tissues was performed. Ki67 positive cells were stained brown (scale bar: 50 mm). (F) TUNEL analyses of the indicated tumor tissues were performed. Apoptotic cells were stained brown (scale bar: 50 mm). (G) Immunohistochemical staining of labeling astrocytes, microglia, and oligodendrocytes in the mice brain by using GFAP, Iba1, and SOX10, respectively (scale bar: 100 mm). (H) Statistical analysis of GFAP-positive, Iba1- positive, and SOX10-positive cells in the mouse brain (n = 3). (The data were expressed as mean ± SD, nsP > 0.05, *P < 0.05, ns means none significance).

Article Snippet: Recombinant human PGK1 (GST-PGK1, ag12119, Proteintech, USA) was purchased from Proteinteck Group, Inc. Antibodies used in this study are as follows: HK1 (#2024, CST, USA), HK2 (#2867, CST, USA), GCK (#3782, CST, USA), ALDOA (#8060, CST, USA), PGK1(sc-130335, Santa Cruz, USA), PGK2 (ab183031, Abcam, USA), GST (#2624, CST, USA), GAPDH (#5174, CST, USA), Beclin-1 (#3495, CST, USA), LC3A/B (#12741, CST, USA), Iba1 (ab178846, Abcam, USA), SOX10 (ab227680, Abcam, USA), GFAP (ab68428, Abcam, USA), and b-Tubulin (#2128, CST, USA).

Techniques: In Vivo, Injection, Immunohistochemical staining, Staining, TUNEL Assay, Labeling

Journal: Frontiers in immunology

Article Title: Inhibition of IP3R/Ca2+ Dysregulation Protects Mice From Ventilator-Induced Lung Injury via Endoplasmic Reticulum and Mitochondrial Pathways.

doi: 10.3389/fimmu.2021.729094

Figure Lengend Snippet: FIGURE 8 | 2-APB inhibits NLRP3 inflammasome activation in HTV-treated mice. (A, B) Representative immunoblots of NLRP3, cleaved caspase-1and Asc in lung extracts from CON, HTV and HTV+2-APB group and densitometric analyses of NLRP3, cleaved caspase-1and Asc. (C) Levels of NLRP3, caspase-1 and Asc mRNA. Data are expressed as means ± SD (n = 6 per group). *P < 0.05 vs. CON group. #P < 0.05 vs. HTV group.

Article Snippet: Genes Primer sequences (5’-3’) Mouse-GRP78 Forward GAAAGGATGGTTAATGATGCTGAG Reverse GTCTTCAATGTCCGCATCCTG Mouse-CHOP Forward CAAATGGCAGTTCAAAACCATC Reverse ATGTGTGCTGTGTGTGTGTTCC Mouse-NLRP3 Forward TGTGAGAAGCAGGTTCTACTCT Reverse GACTGTTGAGGTCCACACTCT Mouse-Caspase-1 Forward AGGCATGCCGTGGAGAGAAACAA Reverse AGCCCCTGACAGGATGTCTCCA Mouse-ASC Forward GACAGTACCAGGCAGTTCGT Reverse AGTCCTTGCAGGTCAGGTTC Mouse-GAPDH Forward TGTGTCCGTCGTGGATCTGA Reverse TTGCTGTTGAAGTCGCAGGAG Se ptember 2021 | Volume 12 | Article 729094 (#2148, CST), anti-GRP78 (sc-166490, Santa Cruz; and/or GB11098, Servicebio), anti-CHOP (sc-7351, Santa Cruz), antiphospho-IRE1a (ab48187, abcam), anti-IRE1a (ab37073, abcam), anti-TRAF2 (#4724, CST), anti-XBP-1s (#40435, CST), anti-phospho-PERK (#3179, CST), anti- PERK (#5683, CST), anti- phospho- eIF2a (AP0635, ABclonal), antieIF2a(A0764, ABclonal), anti-ATF6 (ab37149, abcam), antiIkBa (#4814s, CST), anti-p-NF-kB p65 (Ser536, #3033s, CST), anti-NF-kB p65 (#8242s, CST), anti-Lamin B (sc-374015, Santa Cruz), anti- NLRP3 (#13158, CST), anti-caspase-1 (A0964, ABclonal), anti-ASC (67824S, CST), anti-b-actin (#4970, CST).

Techniques: Activation Assay, Western Blot

Journal: Frontiers in immunology

Article Title: Inhibition of IP3R/Ca2+ Dysregulation Protects Mice From Ventilator-Induced Lung Injury via Endoplasmic Reticulum and Mitochondrial Pathways.

doi: 10.3389/fimmu.2021.729094

Figure Lengend Snippet: FIGURE 11 | Carbachol stimulates mitochondrial dysfunction and NLRP3 inflammasome activation in lung epithelial cells and macrophage. (A, B) Fluorescence microscopy and the ratio of JC-1 staining (red, J-aggregates; green, monomer) in MLE12 and RAW264.7 cells after treating with 50 mM carbachol or non-treated for 24h, Scale bar: 200mm. (C) Levels of ATP. (D, E) Levels of ROS were determined by flow cytometry. (F) Levels of NLRP3, caspase-1and Asc mRNA in MLE12 cells. (G) Levels of NLRP3, caspase-1 and Asc mRNA in RAW264.7 cells. Data are expressed as means ± SD from 3 independent experiments. Mann-Whitney U test was used for caspase-1 mRNA comparison between two groups from MLE12 cells, because the data were non-normally distributed. *P < 0.05 vs. Mock group.

Article Snippet: Genes Primer sequences (5’-3’) Mouse-GRP78 Forward GAAAGGATGGTTAATGATGCTGAG Reverse GTCTTCAATGTCCGCATCCTG Mouse-CHOP Forward CAAATGGCAGTTCAAAACCATC Reverse ATGTGTGCTGTGTGTGTGTTCC Mouse-NLRP3 Forward TGTGAGAAGCAGGTTCTACTCT Reverse GACTGTTGAGGTCCACACTCT Mouse-Caspase-1 Forward AGGCATGCCGTGGAGAGAAACAA Reverse AGCCCCTGACAGGATGTCTCCA Mouse-ASC Forward GACAGTACCAGGCAGTTCGT Reverse AGTCCTTGCAGGTCAGGTTC Mouse-GAPDH Forward TGTGTCCGTCGTGGATCTGA Reverse TTGCTGTTGAAGTCGCAGGAG Se ptember 2021 | Volume 12 | Article 729094 (#2148, CST), anti-GRP78 (sc-166490, Santa Cruz; and/or GB11098, Servicebio), anti-CHOP (sc-7351, Santa Cruz), antiphospho-IRE1a (ab48187, abcam), anti-IRE1a (ab37073, abcam), anti-TRAF2 (#4724, CST), anti-XBP-1s (#40435, CST), anti-phospho-PERK (#3179, CST), anti- PERK (#5683, CST), anti- phospho- eIF2a (AP0635, ABclonal), antieIF2a(A0764, ABclonal), anti-ATF6 (ab37149, abcam), antiIkBa (#4814s, CST), anti-p-NF-kB p65 (Ser536, #3033s, CST), anti-NF-kB p65 (#8242s, CST), anti-Lamin B (sc-374015, Santa Cruz), anti- NLRP3 (#13158, CST), anti-caspase-1 (A0964, ABclonal), anti-ASC (67824S, CST), anti-b-actin (#4970, CST).

Techniques: Activation Assay, Fluorescence, Microscopy, Staining, Cytometry, MANN-WHITNEY, Comparison

Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie

Article Title: The natural product vioprolide A exerts anti-inflammatory actions through inhibition of its cellular target NOP14 and downregulation of importin-dependent NF-ĸB p65 nuclear translocation.

doi: 10.1016/j.biopha.2021.112255

Figure Lengend Snippet: Fig. 7. Vioprolide A reduces importin subunit alpha-1 total protein level and influences importin subunit alpha-1/beta-1 nuclear localization. a-c Confluent HUVECs were treated with vioprolide A (10 nM) as indicated. Total protein levels of importin subunit alpha-1 (a), importin subunit alpha-3 (b) and importin subunit beta-1 (c) were determined by western blot analysis. One representative blot out of 3 is shown. d-f Confluent HUVECs were treated with vioprolide A (10 nM) for 16 h followed by activation with TNF (10 ng/ml) as indicated. The nuclear fractions were separated and total nuclear protein expression of importin subunit alpha-1 (d), importin subunit beta-1 (e) and importin subunit alpha-3 (f) was determined by western blot analysis. One representative blot out of 3 is shown. VioA, vioprolide A; Imp, importin; Topo1, topoisomerase 1. Data are expressed as mean ± SEM. n = 3. *P ≤0.05 vs. negative control (a-c) or TNF control (d-f). #P ≤0.05 vs. negative control (d-f).

Article Snippet: Unspecific binding sites were blocked with 0.2% BSA (MilliporeSigma) for 30 min and cells were treated with primary antibody for 2 h. The following primary antibodies were used: rabbit anti-human NF-ĸB p65 (1:400, sc8008; Santa Cruz Biotechnology) and rabbit anti-human importin subunit alpha-1 (1:400, #14372; Cell Signaling/New England Biolabs).

Techniques: Western Blot, Activation Assay, Expressing, Negative Control, Control

Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie

Article Title: The natural product vioprolide A exerts anti-inflammatory actions through inhibition of its cellular target NOP14 and downregulation of importin-dependent NF-ĸB p65 nuclear translocation.

doi: 10.1016/j.biopha.2021.112255

Figure Lengend Snippet: Fig. 8. NOP14 knockdown influences TNF- activated inflammatory processes in HUVECs. a Confluent HUVECs were treated with 300 nM vioprolide A for 1 h or left untreated. Cells were exposed to increasing temperatures between 42.3 and 57.8 ◦C and lysed by repeated freeze- thaw cycles in liquid nitrogen. Thermal aggre gation curves of NOP14 were analyzed by western blot. One representative blot out of 4 is shown. b-e Subconfluent cells were transfected with siRNA against NOP14 (siNOP14, 60 nM) or non-targeting siRNA (nt siRNA, 60 nM) as control using GeneTrans II Transfection Re agent. 30 h after transfection, HUVECs were treated with 10 nM vioprolide A for 16 h. b HUVECs were activated with TNF (10 ng/ml) for 6 h and fluorescence-labeled THP-1 cells were allowed to adhere to the HUVEC mono layer for 5 min. The amount of adhered THP-1 was detected by fluorescence measurement. c HUVECs were activated with TNF (10 ng/ml) for 4 h. The mRNA expression of ICAM1 was analyzed by quantitative PCR. d HUVECs were activated with TNF (10 ng/ml) for 30 min p65 was visualized by immunocytochemistry and fluorescence microscopy. One representative experiment out of 3 is shown. Scale bar, 200 µm. e Importin subunit alpha-1 was visu alized by immunocytochemistry and fluores cence microscopy. One representative experiment out of 3 is shown. Scale bar, 50 µm. Tagg, aggregation temperature; VioA, vioprolide A. Data are expressed as mean ± SEM. n = 4 (a), n = 5 (b), n = 3 (c-e). *P ≤0.05 vs. TNF control.

Article Snippet: Unspecific binding sites were blocked with 0.2% BSA (MilliporeSigma) for 30 min and cells were treated with primary antibody for 2 h. The following primary antibodies were used: rabbit anti-human NF-ĸB p65 (1:400, sc8008; Santa Cruz Biotechnology) and rabbit anti-human importin subunit alpha-1 (1:400, #14372; Cell Signaling/New England Biolabs).

Techniques: Knockdown, Western Blot, Transfection, Control, Fluorescence, Labeling, Expressing, Real-time Polymerase Chain Reaction, Immunocytochemistry, Microscopy